The relevance of resveratrol in ameliorating carotid atherosclerosis through glycolysis

Abstract

Background

Atherosclerosis (AS) poses a pressing challenge in contemporary medicine. Glycolysis is a crucial bioenergetic metabolic pathway that provides the primary energy source for endothelial cells. Resveratrol (Res) is a natural compound that has been shown to possess AS. However, the underlying mechanisms of its anti-atherosclerotic effects are not yet fully understood.

Methods

We established a balloon injury model of the common carotid artery in Sprague-Dawley (SD) rats and an ox-LDL endothelial cell injury model for in vivo and in vitro experiments, respectively.

Results

Our study showed that 14 days after balloon-induced injury to the carotid intima of SD rats in vitro, the levels of glycolysis-related proteins fructose-2,6-bisphosphatase 3 (PFKFB3), glucose transporter 1 (GLUT1) and hexokinase 2 (HK2) were increased. Meanwhile, Res treatment improved intimal hyperplasia and reduced the levels of expression of these glycolysis-related proteins, and with higher concentrations of Res leading to more pronounced improvements. In vivo, in ox-LDL HUVECs, Res reduced glucose uptake and lactate production, inhibited apoptosis, and decreased the expression of PFKFB3, GLUT1, HK2, and p-AKT. After the addition of a phosphatidylinositol 3-kinase (PI3K) inhibitor, the we established a balloon injury model of the common carotid artery in SD rats and an ox-LDL endothelial cell injury model for in vivo and in vitro experiments, respectively, and expression levels of p-AKT were observed to increase.

Conclusion

According to these findings, Resveratrol can reduce AS by influencing glycolysis and inhibiting apoptosis through the PI3K-AKT signalling pathway.

Background

Atherosclerosis (AS) is a significant global public health issue and the primary pathophysiological mechanism underlying cardiovascular diseases [1]. The incidence of AS has been increasing in recent years, resulting in a severe social, economic, and health burden on the global community. Its prevalence continues to rise, resulting in substantial social, economic, and healthcare burdens worldwide. AS is characterized as a chronic inflammatory disease that encompasses multiple pathological processes, including endothelial dysfunction, lipid deposition, proliferation and migration of vascular smooth muscle cells (VSMCs), foam cell formation, and plaque development. A number of key risk factors related to the development of AS have been identified by epidemiological studies [2]. To date, there remains a lack of effective treatment for AS. Current clinical management of AS primarily involves pharmacological interventions (such as lipid-lowering and antiplatelet drugs) and interventional procedures. However, these treatments have limitations, including suboptimal drug efficacy and the challenge of addressing in-stent restenosis. Therefore, based on our understanding of the pathophysiological mechanisms underlying the development and due to the progression of AS, there is an urgency for the discovery of new therapeutic agents [3].

Glycolysis is a major metabolic pathway in human biosynthesis, where glucose is converted into pyruvate in the cytoplasm. Subsequently, pyruvate can either enter the tricarboxylic acid (TCA) cycle or be converted into lactate through anaerobic fermentation. Glycolysis is an essential pathway for energy acquisition in various cell types, including vascular endothelial cells (ECs), smooth muscle cells, and macrophages [4]. However, during the formation of atherosclerotic plaques, the narrowing of the vessel lumen and the increased oxygen consumption by the vessel wall reduce oxygen transport to the intima. This results in hypoxia in the plaque lesion area, causing the intimal cells to rely on glycolysis for energy production [5]. Xu et al. [6] found that ECs in atherosclerotic exhibit highly active glycolysis. Moreover, the mRNA levels of key glycolytic enzymes, such as hexokinase 2 (HK2), and pyruvate kinase M2 (PKM2), were significantly downregulated in atherosclerotic plaque samples; Xu et al. [7] reported that glycolytic metabolism is already present in the initial stages of AS and exacerbates the inflammatory response of human umbilical vein endothelial cells (HUVECs); Jin et al. [8] reported that dysregulated glucose metabolism is associated with ECs dysfunction; Guo et al. [9] revealed that the expression of fructose- 2,6-biphosphatase 3 (PFKFB3) is associated with atherosclerotic coronary artery disease in patients. Additionally, homozygous deletion of PFKFB3 exacerbates AS in Apoe-/- mice. The aforementioned studies indicate that glycolysis can influence endothelial dysfunction, with its intermediates, enzymes, and metabolic end products regulating the onset and progression of AS. These effects encompass various pathophysiological processes, including vascular endothelial dysfunction, VSMCs proliferation, migration, and phenotypic transformation, lipid accumulation, vascular inflammation, and calcification. Targeting glycolysis to improve AS may have significant clinical implications. However, the relationship between the glycolytic pathway and AS is highly complex. Therefore, are required to fully clarify the mechanisms by which glycolysis influences AS, particularly through its effects on endothelial function.

Resveratrol (Res) is a polyphenolic compound found in a wide variety of natural plants. Previously clinical studies have found that Res can exert its effects by modulating pathways such as oxidative stress, cell death, and inflammation. It has demonstrated significant efficacy in treating various diseases including cancer, neurodegenerative disorders, and cardio protection. Res can regulate various responses associated with endothelial dysfunction, including impaired vasodilation, eNOS uncoupling, leukocyte adhesion, endothelial senescence and endothelial-to-mesenchymal transition (EMT). Further studies have revealed that Res can exert endothelial protective effects by modulating various molecular targets, such as 5’AMP-activated protein kinase (AMPK). These effects ultimately contribute to the improvement of AS [10]. Figueira et al. [11] reported that res reduced serum concentrations of vascular endothelial growth factor and C-reactive protein (CRP) and affected the development of atherosclerotic lesions. Mosavi et al. [12] found that Res significantly reduces aortic wall thickness in mice fed an atherogenic diet, demonstrating both regressive and therapeutic effects on AS. However, whether Res can improve the progression of AS by influencing glycolysis and related functional mechanisms has not been completely elucidated. This study was designed to investigate the effectiveness of Res both in vivo using Sprague-Dawley (SD) rats and in vitro using HUVECs, and to further clarify the mechanisms inherent in their beneficial effects.

Materials and methods

Animals and treatments

Fifty adult male SD rats (12 weeks old, weighing 300–350 g) were obtained from Beijing Vitality River Laboratory Animal Technology Co. All participating SD rats were kept in a proper environment (temperature 23 ± 2 °C, relative humidity 65% ± 5%). They are kept on a cyclic light and dark cycle (12 hours each) with plenty of food and water. We used a suspension of resveratrol prepared with 0.5% carboxymethyl cellulose sodium (CMC-Na) to achieve the desired dosage.

All rats were randomly divided into four groups (10 rats per group, with the remaining 10 rats kept as reserves): (1) sham group; (2) balloon injury group (model group); (3) balloon injury + low-dose resveratrol group (L-Res group, 10 mg/kg/day); (4) balloon injury + high-dose resveratrol group (H-Res group, 50 mg/kg/day).

A carotid balloon injury model was established to induce damage to the carotid intima in SD rats. All participating SD rats were anesthetized using 2% sodium pentobarbital at a dosage of 40 mg/kg, administered intraperitoneally, ensuring adequate sedation and minimizing discomfort throughout the procedures. At the conclusion of the experiments, all animals were humanely euthanized with an overdose of 2% sodium pentobarbital at a dose of 150 mg/kg, also delivered intraperitoneally. This method complies with internationally accepted ethical guidelines for the care and use of laboratory animals, aiming to ensure the animals’ well-being and reduce suffering to the greatest extent possible during both experimental procedures and euthanasia. After anaesthetising successful SD rats, placing on a temperature-controlled surgical table, after disinfecting and preparing the skin, the right common carotid artery and the right external carotid artery of the SD rats were exposed and carefully isolated. A small vessel clamp (length 2.5 cm) was used to occlude the proximal end of the common carotid artery and the distal end of the external carotid artery. A small incision was made at an oblique angle on the external carotid artery. A 2-French Fogarty balloon embolectomy catheter (Edwards Lifesciences, Irvine, CA, USA) was then inserted through the incision in the external carotid artery and advanced into the common carotid artery. A 0.2 mL saline solution was used to inflate the balloon, and the procedure was repeated 3 times, ensuring that the common carotid artery was fully distended each time. After removing the catheter, the distal end of the incision on the external carotid artery was ligated, restoring blood flow Only the right common carotid artery was exposed in the sham operation group. Postoperatively, the SD rats were promptly returned to the temperature-controlled chamber, with special attention given to maintaining their body temperature [13].

Starting from 6:00 AM on the first day before surgery, fasting body weight and quantity of food consumed were recorded every 3 days for a total of 5 times, and measuring serum TG, TC, LDL-C and HDL-C levels in each rat on day 14, with measurements taken at 6:00 AM.

Hematoxylin and eosin staining

Fourteen days after the injury, the segment of the right common carotid artery at the site of the injury was removed and formed into serial cryosections (5 μM thickness), and stained sections with hematoxylin and eosin. Micrographs of the sections were captured using a light microscope (Olympus, Tokyo, Japan), and the cross-sectional area of the lumen of the vascular ring (LA), the area surrounding the inner elastic lamina (IELA), and the area surrounding the outer elastic lamina (EELA), and the total vascular area, were further calculated and measured by using special software; the neointima area was measured. (Endometrial hyperplasia area = IELA-LA; Media area = EELA-IELA; Endometrial hyperplasia degree = endometrial hyperplasia area/media area). Three sections were taken from each group of vessels, the mean value of the data in each group was then calculated separately as the final value for that specimen.

TUNEL

The right common carotid artery tissue was fixed, embedded, and sectioned (4 μM). Sections were pre-treated with poly-L-lysine and hydrated after routine paraffin removal. Proteinase K (1:200 in 0.01M TBS) was applied at 37 °C for 10 minutes, followed by three washes with TBS (2 minutes each). A mixture of 20 μL labeling buffer, 1 μL TdT, and 1 μL BIO-d-UTP was then added, and the sections were incubated at 37 °C for 2 h in a humidified chamber. After removing excess liquid, 50 μL blocking solution was applied for 30 minutes at room temperature. SABC solution (1:100 dilution) was added and incubated at 37 °C for 30 min, followed by four TBS washes (5 min each). Finally, DAPI staining was used to observe the nuclei, with apoptotic cells displaying yellow-green granules and active nuclei showing blue fluorescence under a fluorescence microscope.

Cell glucose detection

The human Glucose detecting kit was purchased from Coibo biotechnology (CB12226-Hu, Shanghai, China). The cells were diluted with PBS (PH7.2–7.4) at a concentration of 10⁶ million/mL. By repeated freezing and thawing, in order to destroy cells and release cellular components. Centrifuge for about 20 min (2000 - 3000 rpm). Collect supernatant carefully. The samples were detected according the manuscripts. Briefly, add enzyme-labeled reagent 100μL per well, then incubation at 37℃ for 60 min. Washing the well, repeat 5 times. Then add color development agent A 50μl to each well first, then add color development agent B 50 μL, gently shake and mix, 37℃ away from light for 15 min. Add termination solution 50 μL per well to terminate the reaction. The absorbance (OD value) of each hole is measured at 450nm.

Lactic acid detection

The human Lactic acid detecting kit was purchased from Coibo biotechnology (CB11218-Hu, Shanghai, China). The cells supernatant was collected and centrifuge for about 20 min (2000 - 3000 rpm). The samples were detected according the manuscripts. Briefly, add enzyme-labeled reagent 100μL per well, then incubation at 37℃ for 60 min. Washing the well, repeat 5 times. Then add color development agent A 50 μL to each well first, then add color development agent B 50 μL, gently shake and mix, 37℃ away from light for 15 min. Add termination solution 50μL per well to terminate the reaction. The absorbance (OD value) of each hole is measured at 450nm.

Cell viability assay

Cell viability was evaluated using the Cell Counting Kit-8 (CCK8) kit (Beyotime, Beijing, China). HUVECs (1 × 10⁴ cells/well) grown in 96-well plates were firstly taken out from the incubator (37 °C, 5% CO₂), and the status, density and number of cells were observed under the microscope. It is intended to add 10 μl of CCK-8 with 100 μl of medium to each well in a 96-well plate and incubated in an incubator (37 °C) for 2 h prior to the addition of the stopping solution, and incubated for 2 h to give an orange-yellow colour. Absorbance values (OD) were recorded at 450 nm with an enzyme labeller/microplate reader (Bio-Rad, Hercules, CA, USA).

Flow cytometric analysis

According to the instructions, apoptosis was detected using the apoptosis detection kit (40302ES20, Yeasen, Shanghai, China). HUVECs (5 × 10⁵/well) were seeded in cell 6-well plates and incubated overnight, then treated with Ox-LDL and resveratrol for 48 h [14]. Cells were washed with phosphate-buffered saline and resuspended in 1× binding buffer after incubation at 37 °C for 48 h. We placed 100 μL of the cell suspension (1 × 10⁶/mL) into a tube, then added 5 μL of fluorochrome-conjugated annexin V and maintained the room temperature for 15 min. We washed the pellet using 1× binding buffer and resuspended it to a volume of 200 μL using 1× binding buffer. Finally, we added 5 μL of propidium iodide staining solution and subjected to flow cytometry (BD Biosciences, San Diego, CA, USA). (The lower left quadrant represents normal cells (Annexin V-PI-), the lower right quadrant represents early apoptotic cells (Annexin V + PI-), the upper right quadrant represents late apoptotic and necrotic cells (Annexin V + PI+), and the upper left quadrant represents cell damaged cells (Annexin V-PI+) that occurred during collection.

Quantitative real-time PCR

Total RNA was extracted by TRIzol reagent (Invitrogen). 0.8 µg of RNA was reverse-transcribed with the ReverTra Ace qPCR RT Master Mix combined with a genomic DNA remover (Toyobo Co., Ltd., Osaka, Japan). A qPCR experiment was completed using 2×SYBR Green qPCR Master Mix (Low ROX; Servicebio) on a 7500 Fast Dx real-time PCR instrument (Thermo Fisher Scientific, Waltham, MA, USA). The primers used were as follows: for PFKFB3, (forward) 5’- TTGGCGTCCCCACAAAAGT - 3’ and (reverse) 5’- AGTTGTAGGAGCTGTACTGCTT - 3’ and, for HK2, (forward) 5’- TTGACCAGGAGATTGACATGGG- 3’ and (reverse) 5’- CAACCGCATCAGGACCTCA - 3’. for Glut1, (forward) 5’- TGGCATCAACGCTGTCTTCT- 3’ and (reverse) 5’- AGCCAATGGTGGCATACACA - 3’. For β-actin, (forward) 5’- CATGTACGTTGCTATCCAGGC- 3’ and (reverse) 5’- CTCCTTAATGTCACGCACGAT - 3’. β-actin was used as an internal control. The comparative threshold cycle method 2^–ΔΔCT was used to calculate the relative expression.

Western blot detection

Total 20 μg protein was primarily separated using a 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis and then transferred using a NC membrane (Millipore). Primary antibodies against Bax (1:1000; Abcam), Caspase-3 (1:1000; Abcam), Cle-Caspase-3 (1:1000; ab182733, Abcam), Bcl-2 (1:1000; ab692, Abcam), Glut1 (1:1000; ab115730, Abcam), HK2 (1:1000; ab209847, Abcam), PFKFB3 (1:1000; ab12594, Abcam), AKT (1:1000; ab8805, Abcam), p-AKT (1:1000; ab81283, Abcam), GAPDH (1:1000; Proteintech) were used for overnight incubation at 4 °C. We washed the sections with phosphate-buffered saline 3 times, then added the corresponding secondary antibodies for incubation for 1 h at room temperature. The proteins were tested using enhanced chemiluminescence solution (Yeason) and detected with the Tanon 5200 scanning system.

Data and statistical analysis

All data were presented as mean ± standard deviation (mean ± SD) and statistically analysed using SPSS 18.0 software. The two Comparisons between groups were made using independent samples t-tests; one-way analysis of variance (ANOVA) was utilised between multiple groups (≥ 3 groups); to ensure the validity of our statistical analysis and to adjust for multiple hypothesis testing, we applied Tukey’s HSD (Honestly Significant Difference) test as a post hoc method following One-Way ANOVA. P < 0.05 was considered statistically significant. The symbols */#/△, **/##, and ***/### are used to indicate P < 0.05, P < 0.01, P < 0.001.

Results

Changes in body weight and four lipid profile parameters in SD rats after balloon injury

During the high-fat diet feeding period, there were no statistically significant differences in initial body weight and average daily caloric intake among the four groups of rats (Fig. 1a).

Fig. 1

Changes in food intake, body weight, and blood lipid levels in SD rats. a, b Changes in food intake and body weight among the four groups of SD rats. c, d, e, f The levels of TC, TG, LDL-C and HDL-C level; All data are presented as the mean ± SD, one-way ANOVA, n ≥ 5 per group, *P < 0.05, **P < 0.01, ^***P < 0.001 vs. sham group; ^#P < 0.05, ^##P < 0.01 vs. injury group; ^△P < 0.05: injury group vs. L-Res+injury group and H-Res+injury. Res: Resveratrol; L-Res: low-dose Res (10 mg/kg/day); H-Res: high-dose Res (50 mg/kg/day); Model: balloon injury

On the 12 th day of high-fat diet feeding, the body weight of rats in L-Res and H-Res groups started to decrease compared to sham and model groups (Fig. 1b), and the difference was statistically significant (P < 0.05); After 14 days of high-fat feeding, the rats in the sham and model groups started to gain weight, and the levels of TC, TG, and LDL-C increased significantly, and the level of HDL-C decreased (Fig. 1c-f), while there was no difference in body weight in L-Res and H-Res groups. After the administration of Res, the levels of TC, TG, and LDL-C were reduced in the L-Res group compared to the H-Res group, and HDL-C levels increased. This indicates the preliminary establishment of an AS animal model and suggests that Res can improve hyperlipidemia levels.

Res attenuates intimal hyperplasia after carotid artery intimal injury in SD rats

On the 14 th day after the injury in SD rats, HE staining was used to observe the pathological changes of vascular lumen and intimal hyperplasia [15]. Compared with the sham group rats, the model group exhibited significant luminal narrowing and thickening, with pronounced intimal hyperplasia. However, treatment with Res reduced endothelial thickening and lumen area stenosis significantly, in the H-Res group, the area and degree of intimal hyperplasia (degree of intimal hyperplasia = intimal hyperplasia area/medial area) were significantly reduced compared to the L-Res group, the I/M results showed that the model group was significantly higher than the Res treatment group (L-Res and H-Res), with the differences being statistically significant (P < 0.05, Fig. 2).

Fig. 2

Res reduced the level of intimal hyperplasia in SD rats. Representative images and statistical results of neointima in arteries stained with hematoxylin and eosin; 5 × magnification: scale bar: 200 µM and 20 × magnification: scale bar: 50 µM. Res: Resveratrol; L-Res: low-dose Res (10 mg/kg/d); H-Res: high-dose Res (50 mg/kg/d); Model: balloon injury. All data are presented as the mean ± SD, one-way ANOVA, n ≥ 5 per group, *P < 0.05, **P < 0.01, ***P < 0.001 vs. sham group; ^#P < 0.05, ^##P < 0.01 vs. model group

Res inhibits the protein expression levels of glycolysis-related enzymes following carotid artery balloon injury in SD rats

After the injury, the expression of glycolysis-related enzymes Glut1, HK2, and PFKFB3 was detected by WB. The protein expression levels of Glut1, HK2, and PFKFB3 were significantly increased in the balloon injury group compared to the sham group; the protein expression levels of Glut1, HK2 and PFKFB3 were down-regulated after two different concentrations of Res treatments (L-Res, H-Res) compared to the model group. Higher concentrations of Res were more significantly reduced than lower concentrations of Res after treatment and the difference was statistically significant (P < 0.001, Fig. 3).

Fig. 3

Res inhibits the protein expression of PFKFB3, GLUT1 and HK2. The protein expression levels of PFKFB3、GLUT1 and HK2 in the different groups. (mean ± SD, P > 0.05, one-way ANOVA, n ≥ 6 per group. *P < 0.05, **P < 0.01, ***P < 0.001 vs. sham group;^#P < 0.05, ^##P < 0.01 vs. model group). Res: Resveratrol; L-Res: low-dose Res (10 mg/kg/day); H-Res: high-dose Res (50 mg/kg/day); Model: balloon injury

The effects of Res on apoptosis and the expression of apoptosis-related proteins in carotid artery intimal cells of SD rats

Apoptosis was detected by TUNEL staining. Compared with the sham group, the number of apoptotic cells were increased in the model group. Meanwhile, the number of apoptotic cells in both groups (L-Res, H-Res) was obviously decreased after Res treatment (Fig. 4a).

Fig. 4

Res influences the protein expression of Bax, Bcl-2, Caspase-3 and Cle-Caspase-3. a TUNEL staining results for the four groups of SD rats; 20 × magnification: scale bar: 50 µM; (b) The protein expression levels of Bax, Bcl-2, Caspase-3 and Cle-Caspase-3 in the different groups. (mean ± SD, one-way ANOVA, n ≥ 6 per group. ^*P < 0.05, ^**P < 0.01, ^***P < 0.001 vs. sham group; ^#P < 0.05, ^##P < 0.01 vs. model group). Res: Resveratrol; L-Res : low-dose Res (10/kg/day); H-Res: high-dose Res (50/kg/day); Model: balloon injury

WB was used to detect the expression of Bax, Bcl-2, Caspase-3 and Cle-Caspase-3 in the common carotid artery of rats on the 14 th day after balloon injury. Compared with the sham group, the model group showed a downregulation in the expression of the anti-apoptotic protein Bcl-2, whereas the expression of apoptosis-related proteins Bax and Cle-Caspase-3 was significantly up-regulated. However, Res treatment significantly reduced the protein expression of Bax and Cle-Caspase-3, and up-regulates the expression of Bcl-2. There was a statistically significant difference between the two high and low doses of Res, suggesting that Res reduced apoptosis after carotid balloon injury in rats (P < 0.001, Fig. 4b).

Res inhibits ox-LDL-induced glycolysis in endothelial cells

Activity of endothelial cells after Res treatment

In this study, we used the CCK-8 assay to evaluate the effects of different concentrations of ox-LDL on the viability of HUVECs after 24 h of treatment. The results indicated that when the concentration of ox-LDL reached 100 µM/L, there was a statistically significant decrease in cell viability. Therefore, this concentration was chosen for all subsequent experiments. HUVECs were pretreated with Res for 2 h before exposure to ox-LDL and then cultured for 24 h. It was observed that pre-treatment with Res at concentrations of 0, 20, 40, 60 and 80 µM/L and recording of cell viability levels of HUVECs showed that Res at 80 µM/L was most effective. Therefore, the single-dose drug concentration at which Res operated on HUVECs cells was set at 80 µM/L in the following study (Fig. 5a, b).

Fig. 5

Assessment of HUVEC viability using the CCK-8 assay. a Cell viability was assessed after treatment with different concentrations of ox-LDL alone. b Cell viability was assessed after treatment with 100 μM ox-LDL and different Res concentrations. All data are presented as the mean ± SD, one-way ANOVA, n ≥ 6 per group, *P < 0.05, **P < 0.01, ***P < 0.001

Glucose uptake and lactate production levels in control and Res groups

Our study measured glucose uptake and LA production levels in the Ctrl, ox-LDL, and Res intervention groups. After Res treatment, PA generation of HUVECs was significantly inhibited. The results showed that Res pretreatment inhibited ox-LDL-induced HUVECs glycolysis (Fig. 6).

Fig. 6

Levels of glucose uptake and lactate production in HUVECs induced by ox-LDL. a Glucose Uptake Levels in ox-LDL-Induced HUVEC after Addition of Res. b Lactate Production Levels in ox-LDL-Induced HUVEC after Addition of Res. All data are presented as the mean ± SD, one-way ANOVA, n ≥ 6 per group, *P < 0.05, **P < 0.01, ***P < 0.001

Res inhibits the protein expression levels of glycolysis-related enzymes in HUVECs induced by ox-LDL

We continued to study the expression of glycolysis-related proteins in ox-LDL-induced. WB results showed that, compared to the ox-LDL group, the expression levels of PFKFB3, GLUT1, and HK2 were significantly inhibited in the Res group (Fig. 7). These data further indicate that Res effectively inhibits glycolysis in ox-LDL-induced HUVECs.

Fig. 7

Res inhibits glycolysis in the ox-LDL-induced HUVECs. a Expression of glycolysis-related proteins detected by WB analysis. b, c, d The effect of Res on the protein levels of GLUT1, HK2, and PFKFB3, respectively. All data are presented as the mean ± SD, one-way ANOVA, n ≥ 6 per group, *P < 0.05, **P < 0.01, ***P < 0.001

Res inhibits apoptosis in ox-LDL-treated HUVECs

Apoptosis refers to a genetically regulated, self-initiated, and orderly process of cell death. In order to further elucidate the underlying mechanism of Res inhibition of HUVECs glycolysis, WB analysis showed that Res pretreatment could reduce the expression of Cle-Caspase-3, a apoptosis-related protein. The apoptosis rates of HUVECs in Veh group, ox-LDL group and ox-LDL+Res group were 91.36%, 76.65% and 69.98%, respectively. These results suggest that Res can alleviate AS by inhibiting apoptosis in a time-dependent manner (Fig. 8a, b). After ox-LDL treatment, cell damage occurred, and the number of oxidizing free radicals increased, and the addition of Res could reduce this damage, that is, Res could inhibit ox-LDL-induced apoptosis and alleviate AS (Fig. 8c).

Fig. 8

Res inhibits apoptosis in HUVECs treated with ox-LDL. a Expression levels of the apoptosis-related proteins Caspase-3 and Cle-Caspase-3. b Apoptotic cells in the different groups were measured using flow cytometry. The right lower quadrant shows early apoptotic cells, the right upper quadrant shows late apoptotic cells, and the left pper quadrant shows necrotic cells. The apoptosis rate was defined as the earlyapoptosis rate plus the late apoptosis rate. c ROS levels were measured using flow cytometry. All data are presented as the mean ± SD, one-way ANOVA, n ≥ 6 per group, *P < 0.05, **P < 0.01, ***P < 0.001

The PI3K/AKT signaling pathway mediates the inhibitory effect of Res on glycolysis in ox-LDL-treated HUVECs

In order to investigate whether the PI3K-AKT pathway is involved in the endothelial injury process induced by Res under ox-LDL, WB was used to detect the protein expression of AKT and its phosphorylated form (p-AKT). The results showed that p-AKT decreased significantly after ox-LDL induction. After the intervention of ox-LDL-induced HUVECs with Res, the inhibitory effect of ox-LDL on p-AKT was significantly weakened (Fig. 9a, b). To further verify whether Res plays a role through the PI3K-Akt pathway, an inhibitor of the PI3K pathway (LY294002) was applied. The results showed that the effect of Res was reversed, and the levels of key glycolytic enzymes (PFKFB3, GLUT1, and HK2) were statistically significant (Fig. 9c).

Fig. 9

The effect of Res on the PI3K/Akt signaling pathway in ox-LDL-induced HUVECs. a HUVECs were treated with res at concentrations of 0.25, 0.5, and 1 μM for 24 h; The levels of PI3K, AKT, and their phosphorylated forms were detected in protein samples using WB. b Cells were treated with the AKT inhibitor LY294002, and the levels of p-AKT were detected using WB. c Levels of the key enzyme of glycolysis (HK2, GLUT1, and PFKFB) after addition of the inhibitor. All data are presented as the mean ± SD, one-way ANOVA, n ≥ 6 per group, *P < 0.05, **P < 0.01, ***P < 0.001

Discussion

AS is an inflammatory disease that primarily affects medium and large arteries. It is mainly mediated by the involvement of three cell types: ECs, macrophages, and smooth muscle cells. ECs, as the first line of defense of the vascular endothelium against external injury, are the initiating factor in AS [16]. Our research explored the significance of glycolysis in AS and endothelial injury. In an SD rat model, Res could reduce carotid intimal hyperplasia and down-regulate key glycolytic enzymes (HK2, PFKFB3, and GLUT1). In an in vitro HUVECs model, we investigated the potential regulatory effects of Res on glycolysis and apoptosis, and verified that the PI3K-AKT signaling pathway might be involved in this process. The PI3K-AKT signaling pathway is generally regarded as an important route in the glycolysis process, regulating key glycolytic molecules such as GLUT1 and HK2 to meet the energy demands of cells under different conditions. In AS, endothelial cell injury, inflammatory responses, and glycolysis are closely related. Res is a natural polyphenol that has been widely reported to have antioxidant, anti-inflammatory, and metabolic regulatory effects, and can exert multiple functions through the PI3K-AKT signaling pathway. Previous studies have confirmed that ox-LDL promotes endothelial cell injury by inhibiting the classical PI3K-AKT pathway [17]. In our experiments, Res could reactivate the PI3K-AKT pathway to maintain cell function. Moreover, the protective effect of Res on HUVECs was significantly lost after the inhibition of the PI3K-AKT pathway, with a significant decrease in the expression of HK2 and GLUT1, further verifying the role of this pathway in the regulation of glycolysis. Therefore, Res may play an important role in ox-LDL-induced HUVEC dysfunction by activating the PI3K-AKT signaling pathway. Res may have potential therapeutic effects on endothelial injury-related diseases in AS. Our findings underscore the potential of targeting glycolytic mechanisms in the treatment of AS and support the use of Res as a promising therapeutic agent for ameliorating AS.

ECs injury and dysfunction are critical initiating factors in the development of AS, under normal physiological conditions, ECs in blood vessels efficiently mediate the exchange of substances between the bloodstream and surrounding tissues, maintain subendothelial collagen levels, and secrete various cytokines, thereby preserving vascular homeostasis and equilibrium, endothelial cell metabolism is considered a potential target for pathological angiogenesis-related diseases, therefore, understanding the bioactivity of ECs under pathological conditions is crucial for elucidating the mechanisms of AS improvement [18]. Several factors can cause endothelial damage, including ox-LDL, angiotensin II (AngII), and shear stress, with ox-LDL being the primary factor. Oxidized ox-LDL can lead to endothelial cell apoptosis, altered secretion of bioactive substances, and reduced antioxidant capacity. Studies have shown that alterations in the glycolytic pathway are a significant metabolic reprogramming event experienced by cells in the atherosclerotic lesion area. This suggests that the regulation of glycolysis may influence the development of AS and offers a new perspective for the treatment of AS. Dou et al. [19] found that the overexpression of miR-143 inhibits glycolysis by downregulating HK2 expression, leading to endothelial cell dysfunction, Abnormal shear stress and other factors can activate ECs, leading to an upregulation of glycolytic metabolism, which in turn promotes the development of AS. Base et al. [20] found that PFKFB3 is a key factor promoting glycolysis, proliferation, and migration in ECs, its inhibitor, 3PO, has shown potential in reducing the vulnerability of atherosclerotic plaques by decreasing glycolysis in ECs and inhibiting angiogenesis and the formation of pathological neovasculature. These findings have provided important clues to the understanding of the pathogenesis of AS and valuable clues for the development of new therapeutic strategies. Consistent with previous studies, we used an atherosclerotic SD rat model with carotid intimal injury and an ox-LDL-induced endothelial cell injury model to further elucidate the mechanisms of endothelial cell damage and explore the relationship between glycolysis and AS. Our experimental results showed that in the balloon injury group of SD rats, there was uneven thickening of the neointima and lumen narrowing. On day 14 of Res treatment, neointimal hyperplasia in the common carotid arteries of balloon-injured rats was significantly reduced, further confirming that Res can inhibit neointimal formation in the carotid arteries of SD rats. Additionally, in the carotid intimal tissue of SD rats and in ox-LDL-induced HUVECs, Res was found to reduce the expression levels of key glycolytic enzymes PFKFB3, GLUT1, and HK2. This suggests that Res may ameliorate the mechanisms and changes associated with the development and progression of atherosclerosis through modulation of glycolysis.

Previous studies have confirmed that endothelial cell injury, along with the development of AS, involves processes such as oxidative stress, tumor necrosis factor (TNF), and high glucose levels, all of which can induce endothelial cell apoptosis. Inflammation and apoptosis, in turn, exacerbate endothelial dysfunction associated with AS [21]. Therefore, inhibiting cell apoptosis may be an effective strategy to improve endothelial-dependent vasodilation in AS. Apoptosis is a form of programmed cell death involved in numerous physiological and pathological processes within the body. ECs apoptosis represents the most severe manifestation of endothelial cell injury. Cle-Caspase-3 is a hallmark of apoptotic cell death and serves as the final executioner in the apoptosis pathway [22]. Shan et al. [23] reported that under unfavorable conditions, apoptosis may also induce AS. During the injury response, apoptosis is initiated through the intrinsic pathway, it is characterized by mitochondrial membrane permeabilization triggered by the oligomerization of the Bcl-2 protein family members Bax and Bak. This process exerts its effects by relying on glycolysis, regulating changes in mitochondrial structure and function, and coupling interactions between intracellular organelles. Jiang et al. [24] found that nonylphenol can inhibit aerobic glycolysis in rats, disrupt intracellular homeostasis, and further induce ROS-mediated apoptosis, thereby suggesting a possible relationship between glycolysis and apoptosis. Hu et al. [25] found that PKM2 can mediate a variety of signaling pathways (e.g. PI3K/AKT, STAT3) to regulate apoptosis, and the mechanisms by which PKM2 regulates apoptosis in different types of cells are not identical. Glycolysis may have some relevance to apoptosis in the regulation of cell biological functions. In this study, we found that Res treatment significantly reduced the protein expression of Bax, Bcl-2, Caspase- 3, and Cle-Caspase-3 in the carotid intimal injury model of SD rats. Additionally, in the ox-LDL-treated HUVECs, Res also lowered the levels of the apoptosis-related proteins Caspase-3 and Cle-Caspase-3. However, glycolysis can regulate apoptosis through several distinct signaling pathways in different diseases or cell types. This phenomenon may be related to the oligomerization, subcellular localization, and post-translational modifications of key glycolytic enzymes in different diseases or cell types. Further in vivo studies and investigations are crucial for elucidating the underlying mechanisms between glycolysis and apoptosis.

Multiple studies have shown that the PI3K/AKT (also known as protein kinase B, PKB) signaling pathway is one of the central pathways mediating various pathophysiological processes. It plays a crucial role in promoting cell proliferation and inhibiting cell apoptosis. The PI3 K/AKT pathway is an intracellular signalling pathway that mediates a wide range of cellular functions including migration, proliferation, differentiation and apoptosis [26]. The PI3K/AKT signaling pathway induces apoptosis through various mechanisms in cells. It can inhibit apoptosis by directly phosphorylating anti-apoptotic factors (such as Bad and Caspases) or by activating transcriptional genes that support cell survival (such as MDM2, IKK, and Yap), additionally, AKT signalling inhibits the activity of the pro-apoptotic factor Bax and controls the permeability of the mitochondrial membrane, thereby inhibiting apoptosis. The PI3K-AKT signalling pathway also has an essential role in the regulation of glycolysis and has been considered as a target for cancer therapy through its influence on cellular metabolism [27]. In a study by Hui et al. [28], it was found that AKT can activate mitochondrial-associated HK2, thereby promoting glycolysis. Additionally, the expression of HK2 can be regulated by the PI3K/AKT/mTORC1 pathway. Xie et al. [29] reported that the PI3K/AKT signaling pathway regulates cell proliferation, migration, differentiation, and apoptosis by activating or inhibiting downstream proteins. It also modulates glycolysis through molecules such as glycogen synthase kinase (GSK) − 3β, an important downstream regulator of Akt, hypoxia-inducible factor-1α (HIF-1α), and platelet-derived growth factor (PDGF). AKT has numerous downstream effects: it activates and inhibits GSK3 and FOXO transcription factors [30], these effects contribute to glucose metabolism and the inhibition of apoptosis in cells. In a study by Wang et al. [31] on glucose metabolism alterations in keloid fibroblasts (KFb), it was found that the PI3K/AKT signaling pathway regulates glycolysis, thereby promoting cell proliferation and inhibiting apoptosis under hypoxic conditions. In the study conducted by Ji et al. [32] on an AS mouse model, it was found that the anti-atherosclerotic activity of Res might be attributed to its regulatory effect on the PI3K/AKT/mTOR signaling pathway. Consistent with multiple studies, our research not only demonstrated the efficacy of Res in ameliorating atherosclerosis but also elucidated the mechanisms through which Res exerts its effects on AS via glycolytic pathways and the PI3K/AKT pathway.

In summary, we explored the significant mechanisms of glycolysis in the development of AS. Res can improve AS by regulating glycolysis, inhibiting apoptosis, and influencing the PI3K/AKT pathway. Meanwhile, this study has certain limitations. For example, other related molecules involved in the PI3K/AKT pathway have not been fully elucidated, AKT regulation has a dual role. Further experiments are needed to clarify the mechanisms linking glycolysis with specific molecules. In conclusion, our study provides new insights into the treatment of AS with Res. Inhibiting glycolysis may be an effective approach for treating AS. This understanding can be leveraged to develop more drugs for treating various atherosclerotic vascular diseases.

Conclusion

The findings of our study indicate that glycolytic mechanisms are implicated in the anti-atherosclerotic effects of Res, revealing that the PI3K-AKT pathway plays a role in the process of ox-LDL-induced endothelial injury. Res can inhibit glycolysis and regulate apoptosis by suppressing this pathway, thereby protecting ECs and reducing the level of AS.